Peaks.js —— 来自 BBC 的音频波形可视化
Sat Aug 15 08:18:10 CST 2015
| 浏览(53)
Peaks.js 基于浏览器的音频波形可视化工具,来自 BBC。 Peaks.js 封装了一组软件工具,可以让用户在浏览器里对音频波形图材料进行查看和交互。
本文地址:Genome Browser FAQ
JavaScript is disabled in your web browserYou must have JavaScript enabled in your web browser to use the Genome Browser
Frequently Asked Questions: Data File Formats
General formats
ENCODE-specific formats
Download-only formats
BED format
BED (Browser Extensible Data) format provides a flexible way to define the data lines that are
displayed in an annotation track. BED lines have three required fields and nine additional optional
fields. The number of fields per line must be consistent throughout any single set of data in an
annotation track.
The order of the optional fields is binding: lower-numbered fields must always
be populated if higher-numbered fields are used.
BED information should not be mixed as explained above (BED3 should not be mixed with BED4), rather
additional column information must be filled for consistency, for example with
some circumstances, if the field content is to be empty. BED fields in custom tracks can be
whitespace-delimited or tab-delimited. Only some variations of BED types, such as
, require a tab character delimitation for
the detail columns.
Please note that only in custom tracks can the first lines of the file consist of header lines,
which begin with the word &browser& or &track& to assist the browser in the
display and interpretation of the lines of BED data following the headers. Such annotation track
header lines are not permissible in downstream utilities such as bedToBigBed, which convert lines of
BED text to indexed binary files.
If your data set is BED-like, but it is very large (over 50MB) and you would like to keep it on your
own server, you should use the
data format.
The first three required BED fields are:
chrom - The name of the chromosome (e.g. chr3, chrY, chr2_random) or scaffold
scaffold10671).
chromStart - The starting position of the feature in the chromosome or scaffold.
The first base in a chromosome is numbered 0.
chromEnd - The ending position of the feature in the chromosome or scaffold. The
chromEnd base is not included in the display of the feature. For example, the first 100
bases of a chromosome are defined as chromStart=0, chromEnd=100, and span the bases
numbered 0-99.
The 9 additional optional BED fields are:
name - Defines the name of the BED line. This label is displayed to the left of
the BED line in the Genome Browser window when the track is open to full display mode or directly
to the left of the item in pack mode.
score - A score between 0 and 1000. If the track line useScore attribute
is set to 1 for this annotation data set, the score value will determine the level of
gray in which this feature is displayed (higher numbers = darker gray). This table shows the
Genome Browser's translation of BED score values into shades of gray:
score in range&&
strand - Defines the strand. Either "." (=no strand) or "+" or "-".
thickStart - The starting position at which the feature is drawn thickly (for
example, the start codon in gene displays). When there is no thick part, thickStart and thickEnd
are usually set to the chromStart position.
thickEnd - The ending position at which the feature is drawn thickly (for example
the stop codon in gene displays).
itemRgb - An RGB value of the form R,G,B (e.g. 255,0,0).
If the track line
itemRgb attribute is set to &On&, this RBG value will determine the display
color of the data contained in this BED line. NOTE: It is recommended that a simple color
scheme (eight colors or less) be used with this attribute to avoid overwhelming the color
resources of the Genome Browser and your Internet browser.
blockCount - The number of blocks (exons) in the BED line.
blockSizes - A comma-separated list of the block sizes. The number of items in
this list should correspond to blockCount.
blockStarts - A comma-separated list of block starts. All of the
blockStart positions should be calculated relative to chromStart. The number of
items in this list should correspond to blockCount.
In BED files with block definitions, the first blockStart value must be 0, so that the first
block begins at chromStart. Similarly, the final blockStart position plus the
final blockSize value must equal chromEnd. Blocks may not overlap.
Here's an example of an annotation track, introduced by a
, that is followed by a complete
BED definition:
track name=pairedReads description=&Clone Paired Reads& useScore=1
cloneA 960 +
2 567,488, 0,3512
cloneB 900 -
2 433,399, 0,3601
This example shows an annotation track that uses the itemRgb attribute to individually color each
data line. In this track, the color scheme distinguishes between items named &Pos*& and
those named &Neg*&. See the usage note in the itemRgb description above for color
palette restrictions. NOTE: The
in this example have been reformatted for documentation purposes. This
can be pasted into the
browser without editing.
browser position chr7:7495720
browser hide all
track name="ItemRGBDemo" description="Item RGB demonstration" visibility=2 itemRgb="On"
to display this track in the Genome Browser.
It is also possible to color items by strand in a BED track using the colorByStrand
attribute in the
as shown below.
For BED tracks, this attribute functions only for custom tracks with 6 to 8 fields (i.e. BED6
through BED8). NOTE: The track and data lines in this example have been reformatted for
documentation purposes. This
can be pasted into the browser without editing.
browser position chr7:7495720
browser hide all
track name="ColorByStrandDemo" description="Color by strand demonstration" visibility=2 colorByStrand="255,0,0 0,0,255"
to display this track in the Genome Browser.
bigBed format
The bigBed format stores annotation items that can either be simple, or a linked collection of
exons, much as
files do. BigBed files are created initially from bed
type files, using the program bedToBigBed. The resulting bigBed files are in an indexed
binary format. The main advantage of the bigBed files is that only the portions of the files needed
to display a particular region are transferred to UCSC, so for large data sets bigBed is
considerably faster than regular bed files. The bigBed file remains on your web accessible server
(http, https, or ftp), not on the UCSC server.
for more information on the bigBed
BED detail format
This is an extension of BED format. BED detail uses the first 4 to 12 columns of BED format, plus
2 additional fields that are used to enhance the track details pages. The first additional field
is an ID, which can be used in place of the name field for creating links from the details pages.
The second additional field is a description of the item, which can be a long description and can
consist of html, including tables and lists.
Requirements for BED detail custom tracks are: fields must be tab-separated,
&type=bedDetail& must be included in the
, and the name and
position fields should uniquely describe items so that the correct ID and description will be
displayed on the details pages.
This example uses the first 4 columns of BED format, but up to 12 may be used. Click
to view this track in the Genome Browser.
track name=HbVar type=bedDetail description="HbVar custom track" db=hg19 visibility=3 url="http://globin.bx.psu.edu/cgi-bin/hbvar/query_vars3?display_format=page&mode=output&id=$$"
chr11	;;Hb_North_York	2619	Hemoglobin variant
chr11	;;HBD c.1 G>A	2659	delta0 thalassemia
chr11	;;Hb Sheffield	2672	Hemoglobin variant
chr11	;;Hb A2-Lyon	2676	Hemoglobin variant
chr11	;;Hb Aix-les-Bains	2677	Hemoglobin variant
bedGraph format
The bedGraph format allows display of continuous-valued data in track format. This display type is
useful for probability scores and transcriptome data. This track type is similar to the
format, but unlike the WIG format, data exported in the bedGraph format
are preserved in their original state. This can be seen on export using the table browser. For more
information about the bedGraph format, please see the
details page.
If you have a very large data set and you would like to keep it on your own server, you should use
PSL format
PSL lines represent alignments, and are typically taken from files generated by BLAT or psLayout.
for more details. All of the following fields are required on each data line
within a PSL file:
matches - Number of bases that match that aren't repeats
misMatches - Number of bases that don't match
repMatches - Number of bases that match but are part of repeats
nCount - Number of &N& bases
qNumInsert - Number of inserts in query
qBaseInsert - Number of bases inserted in query
tNumInsert - Number of inserts in target
tBaseInsert - Number of bases inserted in target
strand - "+& or "-& for query strand. For translated
alignments, second &+&or &-& is for genomic strand
qName - Query sequence name
qSize - Query sequence size
qStart - Alignment start position in query
qEnd - Alignment end position in query
tName - Target sequence name
tSize - Target sequence size
tStart - Alignment start position in target
tEnd - Alignment end position in target
blockCount - Number of blocks in the alignment (a block contains no gaps)
blockSizes - Comma-separated list of sizes of each block
qStarts - Comma-separated list of starting positions of each block in query
tStarts - Comma-separated list of starting positions of each block in target
Here is an example of an annotation track in PSL format. Note that line breaks have been inserted
into the PSL lines in this example for documentation display purposes. This
can be pasted into the
browser without editing.
browser position chr22:74000
browser hide all
track name=fishBlats description=&Fish BLAT& visibility=2
useScore=1
59 9 0 0 1 823 1 96 +- FS_CONTIG_5 171 1062 chr22
53 2 48,20,
59 7 0 0 1 55 1 55 +- FS_CONTIG_5
47 2 21,45,
59 7 0 0 1 55 1 55 -+ FS_CONTIG_5
48 2 45,21,
to display this track in the Genome Browser.
Be aware that the coordinates for a negative strand in a PSL line are handled in a special way. In
the qStart and qEnd fields, the coordinates indicate the position where the
query matches from the point of view of the forward strand, even when the match is on the reverse
strand. However, in the qStarts list, the coordinates are reversed.
Here is a 61-mer containing 2 blocks that align on the minus strand and 2 blocks that align on the
plus strand (this sometimes happens due to assembly errors):
6 tens position in query
0 ones position in query
++++++++++++++
+++++ plus strand alignment on query
------------------
--------------------
minus strand alignment on query
0 ones position in query negative strand coordinates
0 tens position in query negative strand coordinates
Plus strand:
blockSizes=14,5
qStarts=22,56
Minus strand:
blockSizes=20,18
qStarts=5,39
Essentially, the minus strand blockSizes and qStarts are what you would get if
you reverse-complemented the query. However, the qStart and qEnd are not reversed.
Use the following formulas to convert one to the other:
Negative-strand-coordinate-qStart = qSize - qEnd
= 61 - 56 =
Negative-strand-coordinate-qEnd
= qSize - qStart = 61 -
BLAT this actual sequence against hg19 for a real-world example:
GGGTAAAATGAGTTTTTT
GGTCCAATCTTTTA
ATCCACTCCCTACCCTCCTA
Look for the alignment on the negative strand (-) of chr21, which conveniently aligns to the window
chr21:10,000,001-10,000,061.
Browser window coordinates are 1-based [start,end] while PSL coordinates are 0-based [start,end), so
a start of 10,000,001 in the browser corresponds to a start of 10,000,000 in the PSL. Subtracting
10,000,000 from the target (chromosome) position in PSL gives the query negative strand coordinate
The 4, 14, and 5 bases at beginning, middle, and end were chosen to not match with the genome at the
corresponding position.
Protein Query:
A protein query consists of amino acids. To align amino acids against a database of nucleic acids,
each target chromosome is first translated into amino acids for each of the six different reading
frames. The resulting protein PSL the query fields are all in amino acid coordinates
and sizes, while the target database fields are in nucleic acid chromosome coordinates and sizes.
The fields shared by query and target are blockCount and blockSizes. But blockSizes differ between
query (AA) and target (NA), so a single field cannot represent both. A choice was therefore made
to report the blockSizes field in amino acids since it is a protein query.
To find the size of a target exon in nucleic acids, use the formula:
blockSizes[exonNumber]*3
Or, to find the end position of a target exon, use the formula:
tStarts[exonNumber] + (blockSizes[exonNumber]*3)
GFF format
GFF (General Feature Format) lines are based on the Sanger
. GFF lines have nine required fields that must be
tab-separated. If the fields are separated by spaces instead of tabs, the track will not display
correctly. For more information on GFF format, refer to Sanger's
Note that there is also a GFF3 specification that is not currently supported by the Browser.
All GFF tracks must be formatted according to Sanger's GFF2 specification.
If you would like to obtain browser data in GFF (GTF) format, please refer to
on the Wiki.
Here is a brief description of the GFF fields:
seqname - The name of the sequence. Must be a chromosome or scaffold.
source - The program that generated this feature.
feature - The name of this type of feature. Some examples of standard feature
types are &CDS& &start_codon& &stop_codon& and &exon&li>
start - The starting position of the feature in the sequence. The first base is
numbered 1.
end - The ending position of the feature (inclusive).
score - A score between 0 and 1000. If the track line useScore attribute
is set to 1 for this annotation data set, the score value will determine the level of
gray in which this feature is displayed (higher numbers = darker gray). If there is no score
value, enter ":.":.
strand - Valid entries include &+&, &-&, or &.&
(for don't know/don't care).
frame - If the feature is a coding exon, frame should be a number
between 0-2 that represents the reading frame of the first base. If the feature is not a coding
exon, the value should be &.&.
group - All lines with the same group are linked together into a single
Here's an example of a GFF-based track. This
can be pasted into the browser without editing. NOTE: Paste operations on
some operating systems will replace tabs with spaces, which will result in an error when the GFF
track is uploaded. You can circumvent this problem by pasting the URL of the above example
(http://genome.ucsc.edu/goldenPath/help/regulatory.txt) instead of the text itself into the custom
annotation track text box. If you encounter an error when loading a GFF track, check that the data
lines contain tabs rather than spaces.
browser position chr22:25000
browser hide all
track name=regulatory description=&TeleGene(tm) Regulatory Regions&
visibility=2
TeleGene enhancer
TeleGene promoter
TeleGene promoter
to display this track in the Genome Browser.
GTF format
GTF (Gene Transfer Format) is a refinement to GFF that tightens the specification. The first eight
GTF fields are the same as GFF. The group field has been expanded into a list of
attributes. Each attribute consists of a type/value pair. Attributes must end in a
semi-colon, and be separated from any following attribute by exactly one space.
The attribute list must begin with the two mandatory attributes:
gene_id value - A globally unique identifier for the genomic source of
the sequence.
transcript_id value - A globally unique identifier for the predicted
transcript.
Here is an example of the ninth field in a GTF data line:
gene_id "Em:U6.mRNA"; transcript_id "Em:U6.mRNA"; exon_number 1
The Genome Browser groups together GTF lines that have the same transcript_id value. It
only looks at features of type exon and CDS.
For more information on this format, see . If you would like to obtain browser data in
GTF format, please refer to
on the wiki.
HAL format
HAL is a graph-based structure to efficiently store and index multiple genome alignments and
ancestral reconstructions. HAL files are represented in , an open standard for storing and indexing large, compressed
scientific data sets. Genomes within HAL are organized according to the phylogenetic tree that
relate them: each genome is segmented into pairwise DNA alignment blocks with respect to its parent
and children (if present) in the tree. Note that if the phylogeny is unknown, a star tree can be
used. The modularity provided by this tree-based decomposition allows for efficient querying of
sub-alignments, as well as the ability to add, remove and update genomes within the alignment with
only local modifications to the structure. Another important feature of HAL is reference
independence: alignments in this format can be queried with respect to the coordinates of any
genome they contain.
HAL files can be created or read with a comprehensive C++ API (click
for source code and manual).
A set of command line tools is included to perform basic operations, such as importing and exporting
data, identifying mutations, coordinate mapping (liftOver), and comparative assembly hub
generation.
HAL is the native output format of the Progressive Cactus alignment pipeline, and is included in
installation package.
MAF format
The multiple alignment format stores a series of multiple alignments in a format that is easy to
parse and relatively easy to read. This format stores multiple alignments at the DNA level between
entire genomes. Previously used formats are suitable for multiple alignments of single proteins or
regions of DNA without rearrangements, but would require considerable extension to cope with genomic
issues such as forward and reverse strand directions, multiple pieces to the alignment, and so
General Structure
The .maf format is line-oriented. Each multiple alignment ends with a blank line. Each
sequence in an alignment is on a single line, which can get quite long, but there is no length
limit. Words in a line are delimited by any white space. Lines starting with # are considered to be
comments. Lines starting with ## can be ignored by most programs, but contain meta-data of one form
or another.
The file is divided into paragraphs that terminate in a blank line.
Within a paragraph, the first
word of a line indicates its type. Each multiple alignment is in a separate paragraph that begins
with an &a& line and contains an &s& line for each sequence in the multiple
alignment. Some MAF files may contain other optional line types:
an &i& line containing information about what is in the aligned species DNA before and
after the immediately preceding &s& line
an &e& line containing information about the size of the gap between the alignments
that span the current block
a &q& line indicating the quality of each aligned base for the species
Parsers may ignore any other types of paragraphs and other types of lines within an alignment
paragraph.
Custom Tracks
The first line of a custom MAF track must be a &track& line that contains a name=value
pair specifying the track name. Here is an example of a minimal track line:
track name=sample
The following variables can be specified in the track line of a custom MAF:
name=sample - Required. Name of the track.
description="Sample Track" - Optional. Assigns a long name for the track.
frames=multiz28wayFrames - Optional. Tells the browser which table to grab the
gene frames from. This is usually associated with an N-way alignment where the name ends in the
string &Frames&.
mafDot=on - Optional. Use dots instead of bases when bases are identical.
visibility=dense|pack|full - Optional. Sets the default visibility mode for this
speciesOrder="hg18 panTro2" - Optional. White-space separated list specifying the
order in which the sequences in the maf should be displayed.
The second line of a custom MAF track must be a header line as described below.
Header Line
The first line of a .maf file begins with ##maf. This word is followed by
white-space-separated variable=value pairs. There should be no white space surrounding the
##maf version=1 scoring=tba.v8
The currently defined variables are:
version - Required. Currently set to one.
scoring - Optional. A name for the scoring scheme used for the alignments. The
current scoring schemes are:
bit - roughly corresponds to blast bit values (roughly 2 points per aligning base
minus penalties for mismatches and inserts).
blastz - blastz scoring scheme -- roughly 100 points per aligning base.
probability - some score normalized between 0 and 1.
program - Optional. Name of the program generating the alignment.
Undefined variables are ignored by the parser.
The header line is usually followed by a comment line (it begins with a #) that describes the
parameters that were used to run the alignment program:
# tba.v8 (((human chimp) baboon) (mouse rat))
Alignment Block Lines (lines starting with &a& -- parameters for a new
alignment block)
a score=23262.0
Each alignment begins with an &a& line that set variables for the entire alignment block.
The &a& is followed by name=value pairs. There are no required name=value pairs. The
currently defined variables are:
score -- Optional. Floating point score. If this is present, it is good practice
to also define scoring in the first line.
pass -- Optional. Positive integer value. For programs that do multiple pass
alignments such as blastz, this shows which pass this alignment came from. Typically, pass 1 will
find the strongest alignments genome-wide, and pass 2 will find weaker alignments between two
first-pass alignments.
Lines starting with &s& -- a sequence within an alignment block
s hg16.chr7
gcagctgaaaaca
s panTro1.chr6
gcagctgaaaaca
4622798 gcagctgaaaaca
s mm4.chr6
ACAGCTGAAAATA
The &s& lines together with the &a& lines define a multiple alignment.
The &s& lines have the following fields which are defined by position rather than
name=value pairs.
src -- The name of one of the source sequences for the alignment. For sequences
that are resident in a browser assembly, the form 'database.chromosome' allows automatic creation
of links to other assemblies. Non-browser sequences are typically reference by the species name
start -- The start of the aligning region in the source sequence. This is a
zero-based number. If the strand field is &-& then this is the start relative to the
reverse-complemented source sequence (see
size -- The size of the aligning region in the source sequence. This number is
equal to the number of non-dash characters in the alignment text field below.
strand -- Either &+& or &-&. If &-&, then the
alignment is to the reverse-complemented source.
srcSize -- The size of the entire source sequence, not just the parts involved in
the alignment.
text -- The nucleotides (or amino acids) in the alignment and any insertions
(dashes) as well.
Lines starting with &i& -- information about what's happening before and after
this block in the aligning species
s hg16.chr7
gcagctgaaaaca
s panTro1.chr6
gcagctgaaaaca
i panTro1.chr6 N 0 C 0
4622798 gcagctgaaaaca
I 234 n 19
The &i& lines contain information about the context of the sequence lines immediately
preceding them. The following fields are defined by position rather than name=value pairs:
src -- The name of the source sequence for the alignment. Should be the same as
the &s& line immediately above this line.
leftStatus -- A character that specifies the relationship between the sequence in
this block and the sequence that appears in the previous block.
leftCount -- Usually the number of bases in the aligning species between the
start of this alignment and the end of the previous one.
rightStatus -- A character that specifies the relationship between the sequence
in this block and the sequence that appears in the subsequent block.
rightCount -- Usually the number of bases in the aligning species between the end
of this alignment and the start of the next one.
The status characters can be one of the following values:
C -- the sequence before or after is contiguous with this block.
I -- there are bases between the bases in this block and the one before or after
N -- this is the first sequence from this src chrom or scaffold.
n -- this is the first sequence from this src chrom or scaffold but it is bridged
by another alignment from a different chrom or scaffold.
M -- there is missing data before or after this block (Ns in the sequence).
T -- the sequence in this block has been used before in a previous block (likely
a tandem duplication)
Lines starting with &e& -- information about empty parts of the alignment
s hg16.chr7
gcagctgaaaaca
e mm4.chr6
The &e& lines indicate that there isn't aligning DNA for a species but that the current
block is bridged by a chain that connects blocks before and after this block. The following fields
are defined by position rather than name=value pairs.
src -- The name of one of the source sequences for the alignment.
start -- The start of the non-aligning region in the source sequence. This is a
zero-based number. If the strand field is &-& then this is the start relative to the
reverse-complemented source sequence (see
size -- The size in base pairs of the non-aligning region in the source
strand -- Either &+& or &-&. If &-&, then the
alignment is to the reverse-complemented source.
srcSize -- The size of the entire source sequence, not just the parts involved in
alignment and any insertions (dashes) as well.
status -- A character that specifies the relationship between the non-aligning
sequence in this block and the sequence that appears in the previous and subsequent blocks.
The status character can be one of the following values:
C -- the sequence before and after is contiguous implying that this region was
either deleted in the source or inserted in the reference sequence. The browser draws a single
line or a &-& in base mode in these blocks.
I -- there are non-aligning bases in the source species between chained alignment
blocks before and after this block. The browser shows a double line or &=& in base
M -- there are non-aligning bases in the source and more than 90% of them are Ns
in the source. The browser shows a pale yellow bar.
n -- there are non-aligning bases in the source and the next aligning block
starts in a new chromosome or scaffold that is bridged by a chain between still other blocks. The
browser shows either a single line or a double line based on how many bases are in the gap between
the bridging alignments.
Lines starting with &q& -- information about the quality of each aligned base for
the species
s hg18.chr1
32741 26 +
TTTTTGAAAAACAAACAACAAGTTGG
s panTro2.chrUn
TTTTTGAAAAACAAACAACAAGTTGG
q panTro2.chrUn
s dasNov1.scaffold_179265
4584 TT----------AAGCA---------
q dasNov1.scaffold_179265
99----------32239---------
The &q& lines contain a compressed version of the actual raw quality data, representing
the quality of each aligned base for the species with a single character of 0-9 or F. The following
fields are defined by position rather than name=value pairs:
src -- The name of the source sequence for the alignment. Should be the same as
the &s& line immediately preceding this line.
value -- A MAF quality value corresponding to the aligning nucleotide acid in the
preceding &s& line. Insertions (dashes) in the preceding &s& line are
represented by dashes in the &q& line as well. The quality value can be &F&
(finished sequence) or a number derived from the actual quality scores (which range from 0-97) or
the manually assigned score of 98. These numeric values are calculated as:
MAF quality value = min( floor(actual quality value/5), 9 )
This results in the following mapping:
MAF quality value
Raw quality score range
Quality level
Manually assigned
A Simple Example
Here is a simple example of a three alignment blocks derived from five starting sequences. The
first track line is necessary for custom tracks, but should be removed otherwise. Repeats are
shown as lowercase, and each block may have a subset of the input sequences. All sequence columns
and rows must contain at least one nucleotide (no columns or rows that contain only insertions).
track name=euArc visibility=pack
##maf version=1 scoring=tba.v8
# tba.v8 (((human chimp) baboon) (mouse rat))
a score=23262.0
s hg18.chr7
AAA-GGGAATGTTAACCAAATGA---ATTGTCTCTTACGGTG
s panTro1.chr6
AAA-GGGAATGTTAACCAAATGA---ATTGTCTCTTACGGTG
4622798 AAA-GGGAATGTTAACCAAATGA---GTTGTCTCTTATGGTG
s mm4.chr6
-AATGGGAATGTTAAGCAAACGA---ATTGTCTCTCAGTGTG
s rn3.chr4
-AA-GGGGATGCTAAGCCAATGAGTTGTTGTCTCTCAATGTG
a score=5062.0
s hg18.chr7
s panTro1.chr6
4622798 TAAAGA
s mm4.chr6
s rn3.chr4
a score=6636.0
s hg18.chr7
gcagctgaaaaca
s panTro1.chr6
gcagctgaaaaca
4622798 gcagctgaaaaca
s mm4.chr6
ACAGCTGAAAATA
BAM format
BAM is the compressed binary version of the
format, a compact and index-able representation of
nucleotide sequence alignments. Many
work with SAM/BAM. For custom
track display, the main advantage of indexed BAM over PSL and other human-readable alignment formats
is that only the portions of the files needed to display a particular region are transferred to
UCSC. This makes it possible to display alignments from files that are so large that the connection
to UCSC would time out when attempting to upload the whole file to UCSC. Both the BAM file and its
associated index file remain on your web-accessible server (http or ftp), not on the UCSC server.
UCSC temporarily caches the accessed portions of the files to speed up interactive display.
for more information about BAM custom
CRAM format
The CRAM file format is a more dense form of
with the benefit of saving much disk space. While BAM files contain all sequence data within a file,
CRAM files are smaller by taking advantage of an additional external &reference sequence&
file. This file is needed to both compress and decompress the read information.
for more information on the CRAM format.
WIG format
Wiggle format (WIG) allows the display of continuous-valued data in a track format. Click
for more information.
bigWig format
The bigWig format is for display of dense, continuous data that will be displayed in the Genome
Browser as a graph. BigWig files are created initially from
(wig) type
files, using the program wigToBigWig. Alternatively, bigWig files can be created from
files, using the program
bedGraphToBigWig. In either case, the resulting bigWig files are in an indexed binary
format. The main advantage of the bigWig files is that only the portions of the files needed to
display a particular region are transferred to UCSC, so for large data sets bigWig is considerably
faster than regular wiggle files. The bigWig file remains on your web accessible server (http,
https, or ftp), not on the UCSC server. Only the portion that is needed for the chromosomal position
you are currently viewing is locally cached as a &sparse file&.
for more information on the bigWig
Microarray format
The datasets for the built-in microarray tracks in the Genome Browser are stored in BED15 format,
an extension of
format that includes three additional fields: expCount,
expIds, and expScores. To display correctly in the Genome Browser, microarray tracks require the
setting of several attributes in the trackDb file associated with the track's genome assembly.
Each microarray track set must also have an associated microarrayGroups.ra configuration file that
contains additional information about the data in each of the arrays.
User-created microarray custom tracks are similar in format to BED custom tracks with the addition
of three required track line parameters in the header--expNames, expScale, and expStep--that mimic
the trackDb and microarrayGroups.ra settings of built-in microarray tracks.
For a complete description of the microarray track format and an explanation of how to construct a
microarray custom track, see the .
.2bit format
A .2bit file stores multiple DNA sequences (up to 4 Gb total) in a compact randomly-accessible
format. The file contains masking information as well as the DNA itself.
The file begins with a 16-byte header containing the following fields:
signature - the number 0x1A412743 in the architecture of the machine that created
version - zero for now. Readers should abort if they see a version number higher
sequenceCount - the number of sequences in the file.
reserved - always zero for now
All fields are 32 bits unless noted. If the signature value is not as given, the reader program
should byte-swap the signature and check if the swapped version matches. If so, all multiple-byte
entities in the file will have to be byte-swapped. This enables these binary files to be used
unchanged on different architectures.
The header is followed by a file index, which contains one entry for each sequence. Each index entry
contains three fields:
nameSize - a byte containing the length of the name field
name - the sequence name itself, of variable length depending on nameSize
offset - the 32-bit offset of the sequence data relative to the start of the
The index is followed by the sequence records, which contain nine fields:
dnaSize - number of bases of DNA in the sequence
nBlockCount - the number of blocks of Ns in the file (representing unknown
nBlockStarts - an array of length nBlockCount of 32 bit integers indicating the
starting position of a block of Ns
nBlockSizes - an array of length nBlockCount of 32 bit integers indicating the
length of a block of Ns
maskBlockCount - the number of masked (lower-case) blocks
maskBlockStarts - an array of length maskBlockCount of 32 bit integers indicating
the starting position of a masked block
maskBlockSizes - an array of length maskBlockCount of 32 bit integers indicating
the length of a masked block
reserved - always zero for now
packedDna - the DNA packed to two bits per base, represented as so: T - 00,
C - 01, A - 10, G - 11. The first base is in the most significant 2- the last base is in
the least significant 2 bits. For example, the sequence TCAG is represented as .
For a complete definition of all fields in the twoBit format, see
description in the source code.
.nib format
The .nib format pre-dates the .2bit format and is less compact. It describes a DNA sequence by
packing two bases into each byte. Each .nib file contains only a single sequence. The file begins
with a 32-bit signature that is 0x6BE93D3A in the architecture of the machine that created the file
(or possibly a byte-swapped version of the same number on another machine). This is followed by a
32-bit number in the same format that describes the number of bases in the file. Next, the bases
themselves are listed, packed two bases to the byte. The first base is packed in the high-order 4
bits (nibble); the second base is packed in the low-order four bits:
byte = (base1<<4) + base2
The numerical representations for the bases are:
4 - N (unknown)
The most significant bit in a nibble is set if the base is masked.
GenePred table format
genePred is a table format commonly used for gene prediction tracks in the Genome Browser.
Variations of the genePred format are listed below.
If you would like to obtain browser data in GFF (GTF) format, please refer to
on the Wiki.
Gene Predictions
The following definition is used for gene prediction tables.In alternative-splicing situations, each
transcript has a row in this table.
table genePred
"A gene prediction."
"Name of gene"
"Chromosome name"
"+ or - for strand"
"Transcription start position"
"Transcription end position"
"Coding region start"
"Coding region end"
"Number of exons"
uint[exonCount] exonS "Exon start positions"
uint[exonCount] exonE
"Exon end positions"
Gene Predictions (Extended)
The following definition is used for extended gene prediction tables. In alternative-splicing
situations, each transcript has a row in this table. The refGene table is an example of the
genePredExt format.
table genePredExt
"A gene prediction with some additional info."
"Name of gene (usually transcript_id from GTF)"
"Chromosome name"
"+ or - for strand"
"Transcription start position"
"Transcription end position"
"Coding region start"
"Coding region end"
uint exonC
"Number of exons"
uint[exonCount] exonS "Exon start positions"
uint[exonCount] exonE
"Exon end positions"
string name2;
"Alternate name (e.g. gene_id from GTF)"
string cdsStartS
"enum('none','unk','incmpl','cmpl')"
string cdsEndS
"enum('none','unk','incmpl','cmpl')"
lstring exonF
"Exon frame offsets {0,1,2}"
Gene Predictions and RefSeq Genes with Gene Names
A version of genePred that associates the gene name with the gene prediction information. In
alternative-splicing situations, each transcript has a row in this table.
table refFlat
"A gene prediction with additional geneName field."
"Name of gene as it appears in Genome Browser."
"Name of gene"
"Chromosome name"
"+ or - for strand"
"Transcription start position"
"Transcription end position"
"Coding region start"
"Coding region end"
"Number of exons"
uint[exonCount] exonS "Exon start positions"
uint[exonCount] exonE
"Exon end positions"
bigGenePred table format
bigGenePred is a table format commonly used for gene prediction tracks in the Genome Browser.
bigGenePred format is a superset of the
text-based
format supported using the
format, so it can be
efficiently accessed over a network.
for more information on the
bigGenePred format.
bigPsl table format
bigPsl is a table format commonly used to store alignments in the Genome Browser. bigPsl format is a
superset of the
text-based format supported using the
format, so it can be efficiently accessed over a
for more information on the bigPsl
bigMaf table format
bigMaf is a table format commonly used to store multiple alignments in the Genome Browser. bigMaf
format is a superset of the
text-based format supported
format, so it can be efficiently accessed
over a network.
for more information on the bigMaf
bigChain table format
bigChain is a table format commonly used to store pairwise alignments in the Genome Browser.
bigChain format is a superset of the
text-based
format supported using the
format, so it can be
efficiently accessed over a network.
for more information on the bigChain
Personal Genome SNP format
This format is for displaying SNPs from personal genomes. It is the same as is used for the Genome
Variants and Population Variants tracks.
chrom - The name of the chromosome (e.g. chr3, chrY, chr2_random) or scaffold
scaffold10671).
chromStart - The starting position of the feature in the chromosome or scaffold.
The first base in a chromosome is numbered 0.
chromEnd - The ending position of the feature in the chromosome or scaffold. The
chromEnd base is not included in the display of the feature. For example, the first 100
bases of a chromosome are defined as chromStart=0, chromEnd=100, and span the bases
numbered 0-99.
name - The allele or alleles, consisting of one or more A, C, T, or G, optionally
followed by one or more &/& and another allele (there can be more than 2 alleles). A
&-& can be used in place of a base to denote an i if the position
given is zero bases wide, it is an insertion. The alleles are expected to be for the plus
alleleCount - The number of alleles listed in the name field.
alleleFreq - A comma-separated list of the frequency of each allele, given in the
same order as the name field. If unknown, a list of zeroes (matching the alleleCount) should be
alleleScores - A comma-separated list of the quality score of each allele, given
in the same order as the name field. If unknown, a list of zeroes (matching the alleleCount)
should be used.
In the Genome Browser, when viewing the forward strand of the reference genome (the normal case),
the displayed alleles are relative to the forward strand. When viewing the reverse strand of the
reference genome (via the &<--& or &reverse& button), the displayed alleles are
reverse-complemented to match the reverse strand. If the allele frequencies are given, the coloring
of the box will reflect the frequency for each allele.
The details pages for this track type will automatically compute amino acid changes for coding SNPs
as well as give a chart of amino acid properties if there is a non-synonymous change. (The Sift and
PolyPhen predictions that are in some of the Genome Variants subtracks are not available.)
Here is an example of an annotation track in Personal Genome SNP format. The first SNP using a
&-& the second is a deletion. The last 4 SNPs are in a coding region.
track type=pgSnp visibility=3 db=hg19 name="pgSnp" description="Personal Genome SNP example"
browser position chr21:12937
chr21 12008 T/G 2 21,70 90,70
chr21 12032 T/G/A 3 9,60,7 80,80,30
chr21 12035 -/CGG 2 20,80 0,0
chr21 12093 -/CTCGG 2 30,70 0,0
chr21 12278 T 1 15 90
chr21 12772 A 1 36 80
chr21 12828 A/T 2 15,5 0,0
chr21 12880 C 1 0 0
12916 - 1 0 0
VCF format
is a flexible and extendable format (now maintained
by the ) for variation data
such as single nucleotide variants, insertions/deletions, copy number variants and structural
variants. When a VCF file is compressed and indexed using
, and made
web-accessible, the Genome Browser can fetch only the portions of the file necessary to display
items in the viewed region. This makes it possible to display alignments from files that are so
large that the connection to UCSC would time out when attempting to upload the whole file to UCSC.
Both the compressed VCF file and its tabix index file remain on your web-accessible server (http or
ftp), not on the UCSC server. UCSC temporarily caches the accessed portions of the files to speed up
interactive display.
page for more information about
VCF custom tracks.
ENCODE RNA elements: BED6 + 3 scores format
chrom - Name of the chromosome (or contig, scaffold, etc.).
chromStart - The starting position of the feature in the chromosome or scaffold.
The first base in a chromosome is numbered 0.
chromEnd - The ending position of the feature in the chromosome or scaffold. The
chromEnd base is not included in the display of the feature. For example, the first 100
bases of a chromosome are defined as chromStart=0, chromEnd=100, and span the bases
numbered 0-99.
name - Name given to a region (preferably unique). Use &.& if no name
is assigned.
score - Indicates how dark the peak will be displayed in the browser (0-1000). If
all scores were &0& when the data were submitted to the DCC, the DCC assigned scores
1-1000 based on signal value. Ideally the average signalValue per base spread is between
strand - +/- to denote strand or orientation (whenever applicable). Use
&.& if no orientation is assigned.
level - Expression level, e.g. RPKM or FPKM.
signif - Statistical significance, e.g. IDR.
score2 - Additional measurement/count, e.g. number of reads.
ENCODE narrowPeak: Narrow (or Point-Source) Peaks format
This format is used to provide called peaks of signal enrichment based on pooled, normalized
(interpreted) data. It is a BED6+4 format.
chrom - Name of the chromosome (or contig, scaffold, etc.).
chromStart - The starting position of the feature in the chromosome or scaffold.
The first base in a chromosome is numbered 0.
chromEnd - The ending position of the feature in the chromosome or scaffold. The
chromEnd base is not included in the display of the feature. For example, the first 100
bases of a chromosome are defined as chromStart=0, chromEnd=100, and span the bases
numbered 0-99.
name - Name given to a region (preferably unique).
Use &.& if no name
is assigned.
score - Indicates how dark the peak will be displayed in the browser (0-1000). If
all scores were &'0&' when the data were submitted to the DCC, the DCC assigned scores
1-1000 based on signal value. Ideally the average signalValue per base spread is between
strand - +/- to denote strand or orientation (whenever applicable). Use
&.& if no orientation is assigned.
signalValue - Measurement of overall (usually, average) enrichment for the
pValue - Measurement of statistical significance (-log10). Use -1 if no pValue is
qValue - Measurement of statistical significance using false discovery rate
Use -1 if no qValue is assigned.
peak - Point-source
0-based offset from chromStart. Use -1
if no point-source called.
Here is an example of narrowPeak format:
track type=narrowPeak visibility=3 db=hg19 name="nPk" description="ENCODE narrowPeak Example"
browser position chr1:5000
ENCODE broadPeak: Broad Peaks (or Regions) format
This format is used to provide called regions of signal enrichment based on pooled, normalized
(interpreted) data. It is a BED 6+3 format.
chrom - Name of the chromosome (or contig, scaffold, etc.).
chromStart - The starting position of the feature in the chromosome or scaffold.
The first base in a chromosome is numbered 0.
chromEnd - The ending position of the feature in the chromosome or scaffold. The
chromEnd base is not included in the display of the feature. For example, the first 100
bases of a chromosome are defined as chromStart=0, chromEnd=100, and span the bases
numbered 0-99. If all scores were &0& when the data were submitted to the DCC, the DCC
assigned scores 1-1000 based on signal value. Ideally the average signalValue per base spread is
between 100-1000.
name - Name given to a region (preferably unique). Use &.& if no name
is assigned.
score - Indicates how dark the peak will be displayed in the browser
strand - +/- to denote strand or orientation (whenever applicable). Use
&.& if no orientation is assigned.
signalValue - Measurement of overall (usually, average) enrichment for the
pValue - Measurement of statistical significance (-log10). Use -1 if no pValue is
qValue - Measurement of statistical significance using false discovery rate
Use -1 if no qValue is assigned.
Here is an example of broadPeak format:
track type=broadPeak visibility=3 db=hg19 name="bPk" description="ENCODE broadPeak Example"
browser position chr1:700
ENCODE gappedPeak: Gapped Peaks (or Regions) format
This format is used to provide called regions of signal enrichment based on pooled, normalized
(interpreted) data where the regions may be spliced or incorporate gaps in the genomic sequence.
It is a BED12+3 format.
chrom - Name of the chromosome (or contig, scaffold, etc.).
chromStart - The starting position of the feature in the chromosome or scaffold.
The first base in a chromosome is numbered 0.
chromEnd - The ending position of the feature in the chromosome or scaffold. The
chromEnd base is not included in the display of the feature. For example, the first 100
bases of a chromosome are defined as chromStart=0, chromEnd=100, and span the bases
numbered 0-99.
name - Name given to a region (preferably unique). Use &.& if no name
is assigned.
score - Indicates how dark the peak will be displayed in the browser (0-1000). If
all scores were &0& when the data were submitted to the DCC, the DCC assigned scores
1-1000 based on signal value. Ideally the average signalValue per base spread is between
strand - +/- to denote strand or orientation (whenever applicable). Use
&.& if no orientation is assigned.
thickStart - The starting position at which the feature is drawn thickly. Not
used in gappedPeak type, set to 0.
thickEnd - The ending position at which the feature is drawn thickly. Not used in
gappedPeak type, set to 0.
itemRgb - An RGB value of the form R,G,B (e.g. 255,0,0). Not used in gappedPeak
type, set to 0.
blockCount - The number of blocks (exons) in the BED line.
blockSizes - A comma-separated list of the block sizes. The number of items in
this list should correspond to blockCount.
blockStarts - A comma-separated list of block starts. The first value must be 0
and all of the blockStart positions should be calculated relative to chromStart.
The number of items in this list should correspond to blockCount.
signalValue - Measurement of overall (usually, average) enrichment for the
pValue - Measurement of statistical significance (-log10). Use -1 if no pValue is
qValue - Measurement of statistical significance using false discovery rate
Use -1 if no qValue is assigned.
Here is an example of gappedPeak format:
track name=gappedPeakExample type=gappedPeak
chr1 600 Anon_peak_1 55 . 0 0 0 2 400,100 0,500 4.55 5.52807
ENCODE tagAlign: BED3+3 format (historical)
tagAlign was used in hg18, but not in subsequent assemblies. Tag Alignment provided
genomic mapping of short sequence tags. It is a BED3+3 format.
chrom - Name of the chromosome.
chromStart - The starting position of the feature in the chromosome. The first
base in a chromosome is numbered 0.
chromEnd - The ending position of the feature in the chromosome or scaffold. The
chromEnd base is not included in the display of the feature. For example, the first 100 bases of a
chromosome are defined as chromStart=0, chromEnd=100, and span the bases numbered 0-99.
sequence - Sequence of this read.
score - Indicates uniqueness or quality (preferably 1000/alignmentCount).
strand - Orientation of this read (+ or -).
Here is an example of tagAlign format:
chrX 3409 AGAAGGAAAATGATGTGAAGACATA 1000 +
chrX 3412 TCTTATGTCTTCACATCATTTTCCT 500
ENCODE pairedTagAlign: BED6+2 format (historical)
pairedTagAlign was used in hg18, but not in subsequent assemblies. Tag Alignment Format
for Paired Reads was used to provide genomic mapping of paired-read short sequence tags. It is a
BED6+2 format.
chrom - Name of the chromosome.
chromStart - The starting position of the feature in the chromosome. The first
base in a chromosome is numbered 0.
chromEnd - The ending position of the feature in the chromosome or scaffold. The
chromEnd base is not included in the display of the feature. For example, the first 100 bases of a
chromosome are defined as chromStart=0, chromEnd=100, and span the bases numbered 0-99.
name - Identifier of paired-read.
score - Indicates uniqueness or quality (preferably 1000/alignment-count).
strand - Orientation of this read (+ or -).
seq1 - Sequence of first read.
seq2 - Sequence of second read.
ENCODE peptideMapping: BED6+4 format
The peptide mapping format was used to provide genomic mapping of proteogenomic mappings of peptides
to the genome, with information that is appropriate for assessing the confidence of the mapping.
chrom - Name of the chromosome.
chromStart - The starting position of the feature in the chromosome. The first
base in a chromosome is numbered 0.
chromEnd - The ending position of the feature in the chromosome or scaffold. The
chromEnd base is not included in the display of the feature. For example, the first 100 bases of a
chromosome are defined as chromStart=0, chromEnd=100, and span the bases numbered 0-99.
name - The peptide sequence.
score - Indicates uniqueness or quality (preferably 1000/alignment-count).
strand - Orientation of this read (+ or -).
rawScore - Raw score for this hit, as estimated through HMM analysis.
spectrumId - Non-unique identifier for the spectrum file.
peptideRank - Rank of this hit, for peptides with multiple genomic hits.
peptideRepeatCount - Indicates how many times this same hit was observed.
Fasta format
information about fasta format.
FastQ format
for information
about fastq format.